ID: 940836778_940836784

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 940836778 940836784
Species Human (GRCh38) Human (GRCh38)
Location 2:158530689-158530711 2:158530742-158530764
Sequence CCATGTTGGTTGTGGCATATTGA GTCTCACCCTTAGTAACGACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!