ID: 940844903_940844914

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 940844903 940844914
Species Human (GRCh38) Human (GRCh38)
Location 2:158629854-158629876 2:158629903-158629925
Sequence CCCAGCCTCAGCTGGGATTACAG TTTGGATTTTTAGTAGAGTCGGG
Strand - +
Off-target summary No data {0: 9, 1: 2057, 2: 177375, 3: 214821, 4: 129361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!