ID: 940853883_940853888

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 940853883 940853888
Species Human (GRCh38) Human (GRCh38)
Location 2:158714784-158714806 2:158714837-158714859
Sequence CCTTTCCTGGTACTTTGGCTAGA CTGTGCTTGTTGCTGTTTCCAGG
Strand - +
Off-target summary {0: 3, 1: 18, 2: 60, 3: 128, 4: 286} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!