ID: 940856219_940856227

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 940856219 940856227
Species Human (GRCh38) Human (GRCh38)
Location 2:158730575-158730597 2:158730609-158730631
Sequence CCACATGAATGCCCACTACTGAC TAACCTTCAACAGGGGTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88} {0: 1, 1: 1, 2: 1, 3: 9, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!