ID: 940874592_940874602 |
View in Genome Browser |
Spacer: 15 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 940874592 | 940874602 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 2:158886648-158886670 | 2:158886686-158886708 |
| Sequence | CCCGCCCCCTGGATATTAAAAAC | GTGTACACACACTTCGATATTGG |
| Strand | - | + |
| Off-target summary | {0: 5, 1: 29, 2: 14, 3: 37, 4: 219} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||