ID: 940874593_940874602

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 940874593 940874602
Species Human (GRCh38) Human (GRCh38)
Location 2:158886649-158886671 2:158886686-158886708
Sequence CCGCCCCCTGGATATTAAAAACC GTGTACACACACTTCGATATTGG
Strand - +
Off-target summary {0: 6, 1: 28, 2: 17, 3: 48, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!