ID: 940876963_940876968

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 940876963 940876968
Species Human (GRCh38) Human (GRCh38)
Location 2:158907481-158907503 2:158907519-158907541
Sequence CCAGTCCCAGGGTGGTGGGGGTA AGGCCACCAGAAACATATTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 14, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!