ID: 940892855_940892864

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 940892855 940892864
Species Human (GRCh38) Human (GRCh38)
Location 2:159051977-159051999 2:159051997-159052019
Sequence CCTATGGGCATCCCCTGATTTAG TAGGGCATACAGCTGGGGAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 17, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!