ID: 940907153_940907165

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 940907153 940907165
Species Human (GRCh38) Human (GRCh38)
Location 2:159179688-159179710 2:159179726-159179748
Sequence CCCGCTCCACACCCTTCACCCTT TGTGGTGGACTGGACCAGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 24, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!