ID: 940987797_940987801

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 940987797 940987801
Species Human (GRCh38) Human (GRCh38)
Location 2:160065738-160065760 2:160065768-160065790
Sequence CCCCAAAATTTGAGATGGGCCTC TTAGAAAGTTTATTTTGCCAAGG
Strand - +
Off-target summary No data {0: 642, 1: 600, 2: 376, 3: 385, 4: 736}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!