ID: 940992068_940992071

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 940992068 940992071
Species Human (GRCh38) Human (GRCh38)
Location 2:160107615-160107637 2:160107633-160107655
Sequence CCTCAATCTCTTCCACCAGCCTC GCCTCTTTCTCCCCTAGACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 521} {0: 1, 1: 0, 2: 0, 3: 15, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!