ID: 941095940_941095949

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 941095940 941095949
Species Human (GRCh38) Human (GRCh38)
Location 2:161239176-161239198 2:161239227-161239249
Sequence CCCACTCGCTGTCTGGTGAATCG AGTCCAGGCGAATTCAGAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!