ID: 941099731_941099733 |
View in Genome Browser |
Spacer: -5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 941099731 | 941099733 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 2:161282430-161282452 | 2:161282448-161282470 |
| Sequence | CCATCCACTTGCTACTGTCACAC | CACACTCTTGCCAGCAGAAGAGG |
| Strand | - | + |
| Off-target summary | {0: 2, 1: 28, 2: 7, 3: 31, 4: 199} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||