ID: 941110946_941110948

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 941110946 941110948
Species Human (GRCh38) Human (GRCh38)
Location 2:161418164-161418186 2:161418186-161418208
Sequence CCAGGGGCATATGTAAACAATGT TATTTCTTTCTCTAGGAAATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 155} {0: 1, 1: 0, 2: 6, 3: 64, 4: 763}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!