ID: 941118832_941118836

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 941118832 941118836
Species Human (GRCh38) Human (GRCh38)
Location 2:161504989-161505011 2:161505021-161505043
Sequence CCGCAAAAAATTCCAGGCTTCAA TACTAAAAAGCAAAACAGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 30, 4: 470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!