ID: 941129562_941129566

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 941129562 941129566
Species Human (GRCh38) Human (GRCh38)
Location 2:161629684-161629706 2:161629707-161629729
Sequence CCTCTGTGCTCTGCCTATTCATC CCTCCCTTTCCACTAACCCCTGG
Strand - +
Off-target summary {0: 69, 1: 220, 2: 391, 3: 639, 4: 1410} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!