ID: 941151273_941151277

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 941151273 941151277
Species Human (GRCh38) Human (GRCh38)
Location 2:161918730-161918752 2:161918753-161918775
Sequence CCCATCTGAAGTGGCTGCTGCAA AGATGCCAGCTGCAGTAGGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!