ID: 941167123_941167130

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 941167123 941167130
Species Human (GRCh38) Human (GRCh38)
Location 2:162094638-162094660 2:162094676-162094698
Sequence CCTCAGAGACCTCTGTCCTCAGC CTTGGATCTCAGCAGTGCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 462} {0: 1, 1: 0, 2: 0, 3: 12, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!