ID: 941177843_941177852

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 941177843 941177852
Species Human (GRCh38) Human (GRCh38)
Location 2:162221265-162221287 2:162221300-162221322
Sequence CCGGCTCGCTCACGCCAGTAATC GCGGCGGATTTCTTGAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 18, 3: 1197, 4: 3517} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!