ID: 941269527_941269532

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 941269527 941269532
Species Human (GRCh38) Human (GRCh38)
Location 2:163408117-163408139 2:163408153-163408175
Sequence CCTAAAAATGGATTATACTGAGA TGTGCCAGGTCAAAACTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 249} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!