ID: 941282339_941282341

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 941282339 941282341
Species Human (GRCh38) Human (GRCh38)
Location 2:163568650-163568672 2:163568663-163568685
Sequence CCTTTAGAGCTACAATGCTGCTG AATGCTGCTGATGTTGGTATAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 27, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!