ID: 941352792_941352794

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 941352792 941352794
Species Human (GRCh38) Human (GRCh38)
Location 2:164456755-164456777 2:164456798-164456820
Sequence CCAGCTGTTTCTGTGGCAAGTTC CATTGTGCCCAGATGCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 179} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!