ID: 941357650_941357656

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 941357650 941357656
Species Human (GRCh38) Human (GRCh38)
Location 2:164512688-164512710 2:164512738-164512760
Sequence CCCACACACAAGAACAGCAACAA GAAGCTATACAAGAGCAGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!