ID: 941360607_941360614

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 941360607 941360614
Species Human (GRCh38) Human (GRCh38)
Location 2:164546828-164546850 2:164546880-164546902
Sequence CCAAAGGAGACACCAAATCAGAG GGTTCATCCCACAGGTCCCCTGG
Strand - +
Off-target summary No data {0: 2, 1: 4, 2: 16, 3: 40, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!