ID: 941405964_941405965

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 941405964 941405965
Species Human (GRCh38) Human (GRCh38)
Location 2:165088987-165089009 2:165089005-165089027
Sequence CCAATATGTGACATTCTTTAACC TAACCAAGACTTGTGAAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 203} {0: 1, 1: 0, 2: 1, 3: 18, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!