ID: 941472624_941472627

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 941472624 941472627
Species Human (GRCh38) Human (GRCh38)
Location 2:165907754-165907776 2:165907776-165907798
Sequence CCATCCTCCATGAGAGCTGACAG GTTCATTTACTATGAAAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 312} {0: 1, 1: 1, 2: 7, 3: 33, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!