ID: 941482761_941482764

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 941482761 941482764
Species Human (GRCh38) Human (GRCh38)
Location 2:166038250-166038272 2:166038274-166038296
Sequence CCGTCTCAGGCTCATGGCTAATT TTGGACTCCCTAGGAAAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 172} {0: 1, 1: 0, 2: 0, 3: 8, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!