ID: 941561855_941561867

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 941561855 941561867
Species Human (GRCh38) Human (GRCh38)
Location 2:167056801-167056823 2:167056844-167056866
Sequence CCTCCTTCCCTCCATATCCATAT TCTTATAAAGCGGGGAGCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!