ID: 941575043_941575047

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 941575043 941575047
Species Human (GRCh38) Human (GRCh38)
Location 2:167219572-167219594 2:167219599-167219621
Sequence CCTTCATGGATGTGTGACCTGTG TGCACAGGGTCCTGTACTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 191} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!