ID: 941598530_941598536

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 941598530 941598536
Species Human (GRCh38) Human (GRCh38)
Location 2:167508995-167509017 2:167509035-167509057
Sequence CCTTTTGTTCCCAAAGAGTCAAG GACCTTCACGACAGGAAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!