ID: 941615513_941615517

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 941615513 941615517
Species Human (GRCh38) Human (GRCh38)
Location 2:167714110-167714132 2:167714137-167714159
Sequence CCATCCATTTTATCCAAACAAGG TTAAAACTTCTGAGTTCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 5, 3: 10, 4: 163} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!