ID: 941704847_941704850

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 941704847 941704850
Species Human (GRCh38) Human (GRCh38)
Location 2:168647104-168647126 2:168647149-168647171
Sequence CCGGTAAATTGATTTGGGCAGTG TCTTCCTATCCATGAACATAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 15, 3: 88, 4: 312} {0: 1, 1: 4, 2: 60, 3: 154, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!