ID: 941721897_941721900

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 941721897 941721900
Species Human (GRCh38) Human (GRCh38)
Location 2:168821227-168821249 2:168821273-168821295
Sequence CCTGGACTCAGAAGGGTTTATGT CAGCAGTGTGCTCTAACATCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 129} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!