ID: 941826930_941826936

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 941826930 941826936
Species Human (GRCh38) Human (GRCh38)
Location 2:169909116-169909138 2:169909132-169909154
Sequence CCCGGCCTTGATTGGTCCTTTTA CCTTTTAAGGAATTTGTGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 29, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!