ID: 941860299_941860305

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 941860299 941860305
Species Human (GRCh38) Human (GRCh38)
Location 2:170272383-170272405 2:170272419-170272441
Sequence CCAGCTGGTCTCCCTACTTCCAG AATCCATTCCCCACATCAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 11, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!