ID: 941871151_941871152

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 941871151 941871152
Species Human (GRCh38) Human (GRCh38)
Location 2:170387235-170387257 2:170387258-170387280
Sequence CCAACTGGAGTTGTGATGGGGGC AAGAATCTCTGAATATCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 128} {0: 1, 1: 0, 2: 2, 3: 12, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!