ID: 941887009_941887013

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 941887009 941887013
Species Human (GRCh38) Human (GRCh38)
Location 2:170538500-170538522 2:170538516-170538538
Sequence CCTCATGGATCTCTGCTGCAGAA TGCAGAAGAAGGGAGATGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 39, 4: 354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!