ID: 941918778_941918783

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 941918778 941918783
Species Human (GRCh38) Human (GRCh38)
Location 2:170829073-170829095 2:170829091-170829113
Sequence CCCCTCCTCCTTCTGCTTATACA ATACAGCCCATAAACAGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 474} {0: 1, 1: 0, 2: 0, 3: 2, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!