ID: 941951491_941951501

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 941951491 941951501
Species Human (GRCh38) Human (GRCh38)
Location 2:171160826-171160848 2:171160847-171160869
Sequence CCGGCGTCGCCCGGGAGGCGGCG CGGCGGCGGGCTGTGGGTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 184} {0: 1, 1: 0, 2: 5, 3: 75, 4: 678}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!