ID: 941967706_941967712

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 941967706 941967712
Species Human (GRCh38) Human (GRCh38)
Location 2:171315946-171315968 2:171315965-171315987
Sequence CCAGGCACTTGCCAATGACACTG ACTGGAGTAGGGGTAAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 151} {0: 1, 1: 0, 2: 1, 3: 8, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!