ID: 942034728_942034738

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 942034728 942034738
Species Human (GRCh38) Human (GRCh38)
Location 2:171999843-171999865 2:171999874-171999896
Sequence CCCGCGCGCGCACGCGCGCTCCC GCCTCGACGCCTCAGGGCTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 342} {0: 1, 1: 0, 2: 2, 3: 8, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!