ID: 942045846_942045854

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 942045846 942045854
Species Human (GRCh38) Human (GRCh38)
Location 2:172099088-172099110 2:172099111-172099133
Sequence CCCGCGGCGGCTGGGGTGCCGAG CCTGGCCATCTAGGCGGGCGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!