ID: 942098579_942098594

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 942098579 942098594
Species Human (GRCh38) Human (GRCh38)
Location 2:172556315-172556337 2:172556367-172556389
Sequence CCCGCTCTCCATGAAGCAGTTCC TGGGCCTTTTTGCGCGGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 258} {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!