ID: 942181255_942181259

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 942181255 942181259
Species Human (GRCh38) Human (GRCh38)
Location 2:173383290-173383312 2:173383305-173383327
Sequence CCTCGGGAGGTGGTGGAGGTAAG GAGGTAAGTTTTAAGCAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 211} {0: 1, 1: 0, 2: 1, 3: 12, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!