ID: 942249309_942249314

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 942249309 942249314
Species Human (GRCh38) Human (GRCh38)
Location 2:174034100-174034122 2:174034115-174034137
Sequence CCCCAAATGGAGACATCCAGGGG TCCAGGGGACTTTAGATGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!