ID: 942273450_942273455

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 942273450 942273455
Species Human (GRCh38) Human (GRCh38)
Location 2:174300194-174300216 2:174300243-174300265
Sequence CCGCAAGGCAGTCAGGTTATTGT ACATCCTCAGGACACAGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103} {0: 1, 1: 0, 2: 1, 3: 20, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!