ID: 942273521_942273525

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 942273521 942273525
Species Human (GRCh38) Human (GRCh38)
Location 2:174300941-174300963 2:174300960-174300982
Sequence CCACTTTGTATCCCATTTTGGGA GGGAGCACGAAATTACCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 172} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!