ID: 942296797_942296803

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 942296797 942296803
Species Human (GRCh38) Human (GRCh38)
Location 2:174525322-174525344 2:174525349-174525371
Sequence CCACCTCTTAAAAACCCCACCTC GAGTATCACATTGACCAACAAGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 19, 3: 71, 4: 358} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!