ID: 942298591_942298593

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 942298591 942298593
Species Human (GRCh38) Human (GRCh38)
Location 2:174540462-174540484 2:174540489-174540511
Sequence CCAAAAAAAAAAAAAAAAAAAAA AGTTATGCTTAGGACCTCATTGG
Strand - +
Off-target summary {0: 12750, 1: 14510, 2: 25740, 3: 52715, 4: 189344} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!