ID: 942307791_942307798

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 942307791 942307798
Species Human (GRCh38) Human (GRCh38)
Location 2:174625545-174625567 2:174625573-174625595
Sequence CCTCTGTCAATGGGGCTCATGGG CTGCCTCATAGGCTGGTGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 37, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!